NEBuffer Activity/Performance Chart with Restriction Enzymes

NEB’s restriction enzyme buffer system makes your restriction digests easy and convenient. We are able to offer >210 restriction enzymes that cut in a single buffer, CutSmart® .
This improves ease-of-use, especially when performing double digests. In addition to indicating the performance of each enzyme in the 4 NEBuffers, the chart also
indicates ligation and recutting, star activity, and whether or not more than 1-site is required for cleavage.

Should you require information on the pre-2013 buffer system, please refer to the old NEBuffer Activity Chart. You can also receive additional support by contacting

Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent
1.1 2.1 3.1 CutSmart
AatII GACGT/C CutSmart® Buffer 10 50* 50 100 80°C 37°C B
AbaSI CNNNNNNNNNNN/NNNNNNNNNG CutSmart® Buffer 25 50 50 100 65°C 25°C C
Acc65I G/GTACC NEBuffer™ 3.1 10 75* 100 25 65°C 37°C A
AccI GT/MKAC CutSmart® Buffer 50 50 10 100 80°C 37°C A
AciI CCGC(-3/-1) CutSmart® Buffer 10 25 100 100 65°C 37°C A
AclI AA/CGTT CutSmart® Buffer 10 10 10 100 No 37°C B
AcuI CTGAAG(16/14) CutSmart® Buffer + SAM 50 100 50 100 65°C 37°C B
AfeI AGC/GCT CutSmart® Buffer 25 100 25 100 65°C 37°C B
AflII C/TTAAG CutSmart® Buffer 50 100 10 100 65°C 37°C A
AflIII A/CRYGT NEBuffer™ 3.1 10 50 100 50 80°C 37°C B
AgeI § A/CCGGT NEBuffer™ 1.1 100 75 25 75 65°C 37°C C
AgeI-HF® A/CCGGT CutSmart® Buffer 100 50 10 100 65°C 37°C A
AhdI GACNNN/NNGTC CutSmart® Buffer 25 25 10 100 65°C 37°C A
AleI-v2 CACNN/NNGTG CutSmart® Buffer 10 10 10 100 65°C 37°C B
AluI AG/CT CutSmart® Buffer 25 100 50 100 80°C 37°C B
AlwI GGATC(4/5) CutSmart® Buffer 50 50 10 100 No 37°C A
AlwNI CAGNNN/CTG CutSmart® Buffer 10 100 50 100 80°C 37°C A
ApaI GGGCC/C CutSmart® Buffer 25 25 10 100 65°C 25°C A
ApaLI G/TGCAC CutSmart® Buffer 100 100 10 100 No 37°C A
ApeKI G/CWGC NEBuffer™ 3.1 25 50 100 10 No 75°C B
ApoI § R/AATTY NEBuffer™ 3.1 10 75 100 75 80°C 50°C A
ApoI-HF R/AATTY CutSmart® Buffer 10 100 10 100 80°C 37°C B
AscI GG/CGCGCC CutSmart® Buffer 10 10 10 100 80°C 37°C A
AseI AT/TAAT NEBuffer™ 3.1 10 50* 100 10 65°C 37°C B
AsiSI GCGAT/CGC CutSmart® Buffer 100 100 25 100 80°C 37°C B
AvaI C/YCGRG CutSmart® Buffer 10 100 25 100 80°C 37°C A
AvaII G/GWCC CutSmart® Buffer 50 75 10 100 80°C 37°C A
AvrII C/CTAGG CutSmart® Buffer 100 50 50 100 No 37°C B
BaeGI GKGCM/C NEBuffer™ 3.1 75 75 100 25 80°C 37°C A
BaeI (10/15)ACNNNNGTAYC(12/7) CutSmart® Buffer + SAM 50 100 50 100 65°C 25°C A
BamHI § G/GATCC NEBuffer™ 3.1 75* 100* 100 100* No 37°C A
BamHI-HF® G/GATCC CutSmart® Buffer 100 50 10 100 No 37°C A
BanI G/GYRCC CutSmart® Buffer 10 25 10 100 65°C 37°C A
BanII GRGCY/C CutSmart® Buffer 100 100 50 100 80°C 37°C A
BbsI § GAAGAC(2/6) NEBuffer™ 2.1 100 100 25 75 65°C 37°C B
BbsI-HF® GAAGAC(2/6) CutSmart® Buffer 10 10 10 100 65°C 37°C B
BbvCI CCTCAGC(-5/-2) CutSmart® Buffer 10 100 50 100 No 37°C B
BbvI GCAGC(8/12) CutSmart® Buffer 100 100 25 100 65°C 37°C B
BccI CCATC(4/5) CutSmart® Buffer 100 50 10 100 65°C 37°C A
BceAI ACGGC(12/14) NEBuffer™ 3.1 100* 100* 100 100* 65°C 37°C A
BcgI (10/12)CGANNNNNNTGC(12/10) NEBuffer™ 3.1 + SAM 10 75* 100 50* 65°C 37°C A
BciVI GTATCC(6/5) CutSmart® Buffer 100 25 10 100 80°C 37°C C
BclI § T/GATCA NEBuffer™ 3.1 50 100 100 75 No 50°C A
BclI-HF T/GATCA CutSmart® Buffer 100 100 10 100 65°C 37°C B
BcoDI GTCTC(1/5) CutSmart® Buffer 50 75 75 100 No 37°C B
BfaI C/TAG CutSmart® Buffer 10 10 10 100 80°C 37°C B
BfuAI ACCTGC(4/8) NEBuffer™ 3.1 10 25 100 10 65°C 50°C B
BglI GCCNNNN/NGGC NEBuffer™ 3.1 10 25 100 10 65°C 37°C B
BglII A/GATCT NEBuffer™ 3.1 10 10 100 10 No 37°C A
BlpI GC/TNAGC CutSmart® Buffer 50 100 10 100 No 37°C A
BmgBI CACGTC(-3/-3) NEBuffer™ 3.1 10 10 100 10 65°C 37°C B
BmrI ACTGGG(5/4) NEBuffer™ 2.1 75 100 75 100* 65°C 37°C B
BmtI § GCTAG/C NEBuffer™ 3.1 100 100 100 100 65°C 37°C B
BmtI-HF® GCTAG/C CutSmart® Buffer 50 100 10 100 65°C 37°C B
BpmI CTGGAG(16/14) NEBuffer™ 3.1 75 100 100 100 65°C 37°C B
BpuEI CTTGAG(16/14) CutSmart® Buffer + SAM 50* 100 50* 100 65°C 37°C B
Bpu10I CCTNAGC(-5/-2) NEBuffer™ 3.1 10 25 100 25 80°C 37°C B
BsaAI YAC/GTR CutSmart® Buffer 100 100 100 100 No 37°C C
BsaBI GATNN/NNATC CutSmart® Buffer 50 100 75 100 80°C 60°C B
BsaHI GR/CGYC CutSmart® Buffer 50 100 100 100 80°C 37°C C
BsaI § GGTCTC(1/5) CutSmart® Buffer 75* 75 100 100 65°C 37°C B
BsaI-HF®v2 GGTCTC(1/5) CutSmart® Buffer 100 100 100 100 80°C 37°C B
BsaJI C/CNNGG CutSmart® Buffer 50 100 100 100 80°C 60°C A
BsaWI W/CCGGW CutSmart® Buffer 10 100 50 100 80°C 60°C A
BsaXI (9/12)ACNNNNNCTCC(10/7) CutSmart® Buffer 50* 100* 10 100 No 37°C C
BseRI GAGGAG(10/8) CutSmart® Buffer 100 100 75 100 80°C 37°C A
BseYI CCCAGC(-5/-1) NEBuffer™ 3.1 10 50 100 50 80°C 37°C B
BsgI GTGCAG(16/14) CutSmart® Buffer + SAM 25 50 25 100 65°C 37°C B
BsiEI CGRY/CG CutSmart® Buffer 25 50 10 100 No 60°C A
BsiHKAI GWGCW/C CutSmart® Buffer 25 100 100 100 No 65°C A
BsiWI § C/GTACG NEBuffer™ 3.1 25 50* 100 25 65°C 55°C B
BsiWI-HF® C/GTACG CutSmart® Buffer 50 100 10 100 No 37°C B
BslI CCNNNNN/NNGG CutSmart® Buffer 50 75 100 100 No 55°C A
BsmAI GTCTC(1/5) CutSmart® Buffer 50 100 100 100 No 55°C B
BsmBI CGTCTC(1/5) NEBuffer™ 3.1 10 50* 100 25 80°C 55°C B
BsmFI GGGAC(10/14) CutSmart® Buffer 25 50 50 100 80°C 65°C A
BsmI GAATGC(1/-1) CutSmart® Buffer 25 100 10 100 80°C 65°C A
BsoBI C/YCGRG CutSmart® Buffer 25 100 100 100 80°C 37°C A
BspCNI CTCAG(9/7) CutSmart® Buffer + SAM 100 75 10 100 80°C 25°C A
BspDI AT/CGAT CutSmart® Buffer 25 75 50 100 80°C 37°C A
BspEI T/CCGGA NEBuffer™ 3.1 10 10 100 10 80°C 37°C B
BspHI T/CATGA CutSmart® Buffer 10 50 25 100 80°C 37°C A
Bsp1286I GDGCH/C CutSmart® Buffer 25 25 25 100 65°C 37°C A
BspMI ACCTGC(4/8) NEBuffer™ 3.1 10 50* 100 10 65°C 37°C B
BspQI GCTCTTC(1/4) NEBuffer™ 3.1 100* 100* 100 100* 80°C 50°C B
BsrBI CCGCTC(-3/-3) CutSmart® Buffer 50 100 100 100 80°C 37°C A
BsrDI GCAATG(2/0) NEBuffer™ 2.1 10 100 75 25 80°C 65°C A
BsrFI-v2 R/CCGGY CutSmart® Buffer 25 25 0 100 No 37°C C
BsrGI § T/GTACA NEBuffer™ 2.1 25 100 100 25 80°C 37°C A
BsrGI-HF® T/GTACA CutSmart® Buffer 10 100 100 100 80°C 37°C A
BsrI ACTGG(1/-1) NEBuffer™ 3.1 10 50 100 10 80°C 65°C B
BssHII G/CGCGC CutSmart® Buffer 100 100 100 100 65°C 50°C B
BssSI-v2 CACGAG(-5/-1) CutSmart® Buffer 10 25 10 100 No 37°C B
BstAPI GCANNNN/NTGC CutSmart® Buffer 50 100 25 100 80°C 60°C A
BstBI TT/CGAA CutSmart® Buffer 75 100 10 100 No 65°C A
BstEII  § G/GTNACC NEBuffer™ 3.1 10 75* 100 75* No 60°C A
BstEII-HF® G/GTNACC CutSmart® Buffer 10 10 10 100 No 37°C A
BstNI CC/WGG NEBuffer™ 3.1 10 100 100 75 No 60°C A
BstUI CG/CG CutSmart® Buffer 50 100 25 100 No 60°C A
BstXI CCANNNNN/NTGG NEBuffer™ 3.1 10 50 100 25 80°C 37°C B
BstYI R/GATCY NEBuffer™ 2.1 25 100 75 100 No 60°C A
BstZ17I-HF® GTATAC CutSmart® Buffer 100 100 10 100 No 37°C A
Bsu36I CC/TNAGG CutSmart® Buffer 25 100 100 100 80°C 37°C C
BtgI C/CRYGG CutSmart® Buffer 50 100 100 100 80°C 37°C B
BtgZI GCGATG(10/14) CutSmart® Buffer 10 25 10 100 80°C 60°C A
BtsCI GGATG(2/0) CutSmart® Buffer 10 100 25 100 80°C 50°C B
BtsIMutI CAGTG(2/0) CutSmart® Buffer 100 50 10 100 80°C 55°C A
BtsI-v2 GCAGTG(2/0) CutSmart® Buffer 100 100 25 100 No 55°C A
Cac8I GCN/NGC CutSmart® Buffer 50 75 100 100 65°C 37°C B
ClaI AT/CGAT CutSmart® Buffer 10 50 50 100 65°C 37°C A
CspCI (11/13)CAANNNNNGTGG(12/10) CutSmart® Buffer + SAM 10 100 10 100 65°C 37°C A
CviAII C/ATG CutSmart® Buffer 50 50 10 100 65°C 25°C C
CviKI-1 RG/CY CutSmart® Buffer 25 100 100 100 No 37°C A
CviQI G/TAC NEBuffer™ 3.1 75 100* 100 75* No 25°C C
DdeI C/TNAG CutSmart® Buffer 75 100 100 100 65°C 37°C B
DpnI GA/TC CutSmart® Buffer 100 100 75 100 80°C 37°C B
DpnII /GATC NEBuffer™ DpnII 25 25 100* 25 65°C 37°C B
DraI TTT/AAA CutSmart® Buffer 75 75 50 100 65°C 37°C A
DraIII-HF® CACNNN/GTG CutSmart® Buffer 10 50 10 100 No 37°C B
DrdI GACNNNN/NNGTC CutSmart® Buffer 25 50 10 100 65°C 37°C A
EaeI Y/GGCCR CutSmart® Buffer 10 50 10 100 65°C 37°C A
EagI § C/GGCCG NEBuffer™ 3.1 10 25 100 10 65°C 37°C B
EagI-HF® C/GGCCG CutSmart® Buffer 25 100 100 100 65°C 37°C B
EarI CTCTTC(1/4) CutSmart® Buffer 50 10 10 100 65°C 37°C B
EciI GGCGGA(11/9) CutSmart® Buffer 100 50 50 100 65°C 37°C A
Eco53kI GAG/CTC CutSmart® Buffer 100 100 10 100 65°C 37°C A
EcoNI CCTNN/NNNAGG CutSmart® Buffer 50 100 75 100 65°C 37°C A
EcoO109I RG/GNCCY CutSmart® Buffer 50 100 50 100 65°C 37°C A
EcoP15I CAGCAG(25/27) NEBuffer™ 3.1 + ATP 75 100 100 100 65°C 37°C A
EcoRI § G/AATTC NEBuffer™ EcoRI 25 100* 50 50* 65°C 37°C C
EcoRI-HF® G/AATTC CutSmart® Buffer 10 100 10 100 65°C 37°C C
EcoRV § GAT/ATC NEBuffer™ 3.1 10 50 100 10 80°C 37°C A
EcoRV-HF® GAT/ATC CutSmart® Buffer 25 100 100 100 65°C 37°C B
Esp3I CGTCTC(1/5) CutSmart® Buffer 100 100 10 100 65°C 37°C B
FatI 0 NEBuffer™ 2.1 10 100 50 50 80°C 55°C A
FauI CCCGC(4/6) CutSmart® Buffer 100 50 10 100 65°C 55°C A
Fnu4HI GC/NGC CutSmart® Buffer 10 10 10 100 No 37°C A
FokI GGATG(9/13) CutSmart® Buffer 100 100 75 100 65°C 37°C A
FseI GGCCGG/CC CutSmart® Buffer 100 75 10 100 65°C 37°C B
FspEI CC(12/16) CutSmart® Buffer 10 10 10 100 80°C 37°C B
FspI TGC/GCA CutSmart® Buffer 10 100 10 100 No 37°C C
HaeII RGCGC/Y CutSmart® Buffer 25 100 10 100 80°C 37°C A
HaeIII GG/CC CutSmart® Buffer 50 100 25 100 80°C 37°C A
HgaI GACGC(5/10) NEBuffer™ 1.1 100 100 25 100 65°C 37°C A
HhaI GCG/C CutSmart® Buffer 25 100 100 100 65°C 37°C A
HincII GTY/RAC NEBuffer™ 3.1 25 100 100 100 65°C 37°C B
HindIII § A/AGCTT NEBuffer™ 2.1 25 100 50 50 80°C 37°C B
HindIII-HF® A/AGCTT CutSmart® Buffer 10 100 10 100 80°C 37°C B
HinfI G/ANTC CutSmart® Buffer 50 100 100 100 80°C 37°C A
HinP1I G/CGC CutSmart® Buffer 100 100 100 100 65°C 37°C A
HpaI GTT/AAC CutSmart® Buffer 10 75* 25 100 No 37°C A
HpaII C/CGG CutSmart® Buffer 100 50 10 100 80°C 37°C A
HphI GGTGA(8/7) CutSmart® Buffer 50 50 10 100 65°C 37°C B
HpyAV CCTTC(6/5) CutSmart® Buffer 100 100 25 100 65°C 37°C 0
HpyCH4III ACN/GT CutSmart® Buffer 100 25 10 100 65°C 37°C A
HpyCH4IV A/CGT CutSmart® Buffer 100 50 25 100 65°C 37°C A
HpyCH4V TG/CA CutSmart® Buffer 50 50 25 100 65°C 37°C A
Hpy188I TCN/GA CutSmart® Buffer 25 100 50 100 65°C 37°C A
Hpy99I CGWCG/ CutSmart® Buffer 50 10 10 100 65°C 37°C A
Hpy166II GTN/NAC CutSmart® Buffer 100 100 50 100 65°C 37°C C
Hpy188III TC/NNGA CutSmart® Buffer 100 100 10 100 65°C 37°C B
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) CutSmart® Buffer 10 10 10 100 65°C 37°C B
I-SceI TAGGGATAACAGGGTAAT(-9/-13) CutSmart® Buffer 10 50 25 100 65°C 37°C B
KasI G/GCGCC CutSmart® Buffer 50 100 50 100 65°C 37°C B
KpnI § GGTAC/C NEBuffer™ 1.1 100 75 10 50* No 37°C A
KpnI-HF® GGTAC/C CutSmart® Buffer 100 25 10 100 No 37°C A
LpnPI CCDG(10/14) CutSmart® Buffer 10 10 10 100 65°C 37°C B
MboI /GATC CutSmart® Buffer 75 100 100 100 65°C 37°C A
MboII GAAGA(8/7) CutSmart® Buffer 100* 100 50 100 65°C 37°C C
MfeI § C/AATTG CutSmart® Buffer 75 50 10 100 No 37°C A
MfeI-HF® C/AATTG CutSmart® Buffer 75 25 10 100 No 37°C A
MluCI /AATT CutSmart® Buffer 100 10 10 100 No 37°C A
MluI § A/CGCGT NEBuffer™ 3.1 10 50 100 25 80°C 37°C A
MluI-HF® A/CGCGT CutSmart® Buffer 25 100 100 100 No 37°C A
MlyI GAGTC(5/5) CutSmart® Buffer 50 50 10 100 65°C 37°C A
MmeI TCCRAC(20/18) CutSmart® Buffer + SAM 50 100 50 100 65°C 37°C B
MnlI CCTC(7/6) CutSmart® Buffer 75 100 50 100 65°C 37°C B
MscI TGG/CCA CutSmart® Buffer 25 100 100 100 80°C 37°C C
MseI T/TAA CutSmart® Buffer 75 100 75 100 65°C 37°C A
MslI CAYNN/NNRTG CutSmart® Buffer 50 50 10 100 80°C 37°C A
MspA1I CMG/CKG CutSmart® Buffer 10 50 10 100 65°C 37°C B
MspI C/CGG CutSmart® Buffer 75 100 50 100 No 37°C A
MspJI CNNR(9/13) CutSmart® Buffer 10 10 10 100 65°C 37°C B
MwoI GCNNNNN/NNGC CutSmart® Buffer 10 100 100 100 No 60°C B
NaeI GCC/GGC CutSmart® Buffer 25 25 10 100 No 37°C A
NarI GG/CGCC CutSmart® Buffer 100 100 10 100 65°C 37°C A
Nb.BbvCI 0 CutSmart® Buffer 25 100 100 100 80°C 37°C A
Nb.BsmI 0 NEBuffer™ 3.1 10 50 100 10 80°C 65°C A
Nb.BsrDI 0 CutSmart® Buffer 25 100 100 100 80°C 65°C A
Nb.BssSI 0 NEBuffer™ 3.1 10 100 100 25 No 37°C B
Nb.BtsI 0 CutSmart® Buffer 75 100 75 100 80°C 37°C A
NciI CC/SGG CutSmart® Buffer 100 25 10 100 No 37°C A
NcoI § C/CATGG NEBuffer™ 3.1 100 100 100 100 80°C 37°C A
NcoI-HF® C/CATGG CutSmart® Buffer 50 100 10 100 80°C 37°C B
NdeI CA/TATG CutSmart® Buffer 75 100 100 100 65°C 37°C A
NgoMIV G/CCGGC CutSmart® Buffer 100 50 10 100 No 37°C A
NheI § G/CTAGC NEBuffer™ 2.1 100 100 10 100 65°C 37°C C
NheI-HF® G/CTAGC CutSmart® Buffer 100 25 10 100 80°C 37°C C
NlaIII CATG/ CutSmart® Buffer 10 10 10 100 65°C 37°C B
NlaIV GGN/NCC CutSmart® Buffer 10 10 10 100 65°C 37°C B
NmeAIII GCCGAG(21/19) CutSmart® Buffer + SAM 10 10 10 100 65°C 37°C B
NotI § GC/GGCCGC NEBuffer™ 3.1 10 50 100 25 65°C 37°C C
NotI-HF® GC/GGCCGC CutSmart® Buffer 25 100 25 100 65°C 37°C A
NruI § TCG/CGA NEBuffer™ 3.1 10 10 100 10 No 37°C A
NruI-HF® TCG/CGA CutSmart® Buffer 0 25 50 100 No 37°C A
NsiI § ATGCA/T NEBuffer™ 3.1 10 75 100 25 65°C 37°C B
NsiI-HF® ATGCA/T CutSmart® Buffer 10 20 10 100 80°C 37°C B
NspI RCATG/Y CutSmart® Buffer 100 100 10 100 65°C 37°C A
Nt.AlwI GGATC(4/-5) CutSmart® Buffer 10 100 100 100 80°C 37°C A
Nt.BbvCI CCTCAGC(-5/-7) CutSmart® Buffer 50 100 10 100 80°C 37°C A
Nt.BsmAI GTCTC(1/-5) CutSmart® Buffer 100 50 10 100 65°C 37°C A
Nt.BspQI GCTCTTC(1/-7) NEBuffer™ 3.1 10 25 100 10 80°C 50°C B
Nt.BstNBI GAGTC(4/-5) NEBuffer™ 3.1 0 10 100 10 80°C 55°C A
Nt.CviPII (0/-1)CCD CutSmart® Buffer 10 100 25 100 65°C 37°C A
PacI TTAAT/TAA CutSmart® Buffer 100 75 10 100 65°C 37°C A
PaeR7I C/TCGAG CutSmart® Buffer 25 100 10 100 No 37°C A
PciI A/CATGT NEBuffer™ 3.1 50 75 100 50* 80°C 37°C B
PflFI GACN/NNGTC CutSmart® Buffer 25 100 25 100 65°C 37°C A
PflMI CCANNNN/NTGG NEBuffer™ 3.1 0 100 100 50 65°C 37°C A
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer™ PI-SceI + BSA 10 10 10 10 65°C 37°C B
PleI GAGTC(4/5) CutSmart® Buffer 25 50 25 100 65°C 37°C A
PluTI GGCGC/C CutSmart® Buffer 100 25 10 100 65°C 37°C A
PmeI GTTT/AAAC CutSmart® Buffer 10 50 10 100 65°C 37°C A
PmlI CAC/GTG CutSmart® Buffer 100 50 10 100 65°C 37°C A
PpuMI RG/GWCCY CutSmart® Buffer 10 10 10 100 No 37°C B
PshAI GACNN/NNGTC CutSmart® Buffer 25 50 10 100 65°C 37°C A
PsiI TTA/TAA CutSmart® Buffer 10 100 10 100 65°C 37°C B
PspGI /CCWGG CutSmart® Buffer 25 100 50 100 No 75°C A
PspOMI G/GGCCC CutSmart® Buffer 10 10 10 100 65°C 37°C B
PspXI VC/TCGAGB CutSmart® Buffer 10 100 25 100 No 37°C B
PstI § CTGCA/G NEBuffer™ 3.1 75 75 100 50* 80°C 37°C C
PstI-HF® CTGCA/G CutSmart® Buffer 10 75 50 100 No 37°C C
PvuI § CGAT/CG NEBuffer™ 3.1 10 25 100 10 No 37°C B
PvuI-HF® CGAT/CG CutSmart® Buffer 25 100 100 100 No 37°C B
PvuII § CAG/CTG NEBuffer™ 3.1 50 100 100 100* No 37°C B
PvuII-HF® CAG/CTG CutSmart® Buffer 10 10 10 100 No 37°C B
RsaI GT/AC CutSmart® Buffer 25 50 10 100 No 37°C A
RsrII CG/GWCCG CutSmart® Buffer 25 75 10 100 65°C 37°C C
SacI § GAGCT/C NEBuffer™ 1.1 100 50 10 100 65°C 37°C A
SacI-HF® GAGCT/C CutSmart® Buffer 10 50 10 100 65°C 37°C A
SacII CCGC/GG CutSmart® Buffer 10 100 10 100 65°C 37°C A
SalI § G/TCGAC NEBuffer™ 3.1 10 10 100 10 65°C 37°C A
SalI-HF® G/TCGAC CutSmart® Buffer 10 100 100 100 65°C 37°C A
SapI GCTCTTC(1/4) CutSmart® Buffer 75 50 10 100 65°C 37°C B
Sau3AI /GATC NEBuffer™ 1.1 100 50 10 100 65°C 37°C A
Sau96I G/GNCC CutSmart® Buffer 50 100 100 100 65°C 37°C A
SbfI § CCTGCA/GG CutSmart® Buffer 50 25 10 100 80°C 37°C A
SbfI-HF® CCTGCA/GG CutSmart® Buffer 50 25 10 100 80°C 37°C B
ScaI-HF® AGT/ACT CutSmart® Buffer 100 100 10 100 80°C 37°C B
ScrFI CC/NGG CutSmart® Buffer 100 100 100 100 65°C 37°C C
SexAI A/CCWGGT CutSmart® Buffer 100 75 50 100 65°C 37°C A
SfaNI GCATC(5/9) NEBuffer™ 3.1 10 75 100 25 65°C 37°C B
SfcI C/TRYAG CutSmart® Buffer 75 50 25 100 65°C 37°C B
SfiI GGCCNNNN/NGGCC CutSmart® Buffer 25 100 50 100 No 50°C C
SfoI GGC/GCC CutSmart® Buffer 50 100 100 100 No 37°C B
SgrAI CR/CCGGYG CutSmart® Buffer 100 100 10 100 65°C 37°C A
SmaI CCC/GGG CutSmart® Buffer 10 10 10 100 65°C 25°C B
SmlI C/TYRAG CutSmart® Buffer 25 75 25 100 No 55°C A
SnaBI TAC/GTA CutSmart® Buffer 50* 50 10 100 80°C 37°C A
SpeI § A/CTAGT CutSmart® Buffer 75 100 25 100 80°C 37°C C
SpeI-HF® A/CTAGT CutSmart® Buffer 25 50 10 100 80°C 37°C C
SphI § GCATG/C NEBuffer™ 2.1 100 100 50 100 65°C 37°C B
SphI-HF® GCATG/C CutSmart® Buffer 50 25 10 100 65°C 37°C B
SrfI GCCC/GGGC CutSmart® Buffer 10 50 0 100 65°C 37°C B
SspI § AAT/ATT NEBuffer™ SspI 50 100 50 50 65°C 37°C C
SspI-HF® AAT/ATT CutSmart® Buffer 25 100 10 100 65°C 37°C B
StuI AGG/CCT CutSmart® Buffer 50 100 50 100 No 37°C A
StyD4I /CCNGG CutSmart® Buffer 10 100 100 100 65°C 37°C B
StyI § C/CWWGG NEBuffer™ 3.1 10 25 100 10 65°C 37°C A
StyI-HF® C/CWWGG CutSmart® Buffer 25 100 25 100 65°C 37°C A
SwaI ATTT/AAAT NEBuffer™ 3.1 10 10 100 10 65°C 25°C B
TaqI-v2 T/CGA CutSmart® Buffer 50 75 100 100 80°C 65°C B
TfiI G/AWTC CutSmart® Buffer 50 100 100 100 No 65°C C
TseI G/CWGC CutSmart® Buffer 75 100 100 100 No 65°C B
Tsp45I /GTSAC CutSmart® Buffer 100 50 10 100 No 65°C A
TspMI C/CCGGG CutSmart® Buffer 50* 75* 50* 100 No 75°C B
TspRI NNCASTGNN/ CutSmart® Buffer 25 50 25 100 No 65°C B
Tth111I GACN/NNGTC CutSmart® Buffer 25 100 25 100 No 65°C B
XbaI T/CTAGA CutSmart® Buffer 10 100 75 100 65°C 37°C A
XcmI CCANNNNN/NNNNTGG NEBuffer™ 2.1 10 100 25 100 65°C 37°C C
XhoI C/TCGAG CutSmart® Buffer 75 100 100 100 65°C 37°C A
XmaI C/CCGGG CutSmart® Buffer 25 50 10 100 65°C 37°C A
XmnI GAANN/NNTTC CutSmart® Buffer 50 75 10 100 65°C 37°C A
ZraI GAC/GTC CutSmart® Buffer 100 25 10 100 80°C 37°C B

§ An HF version of this enzyme is available.

The values listed in this table are approximate. They were obtained using each enzyme's specific unit assay substrate DNA.

Ligation and Recutting Notes
a. Ligation is less than 10%.
b. Ligation is 25% -75%.
c. Recutting after ligation is less than 5%.
d. Recutting after ligation is 50% -75%.
e. Ligation and recutting after ligation is not applicable since the enzyme is either a nicking enzyme, is affected by methylation, or the recognition sequence contains variable sequences.

Star Activity Notes
1. Star Activity may result from extended digestion, high enzyme concentration or a glycerol concentration of > 5%.
2. Star Activity may result from extended digestion.
3. Star Activity may result from a glycerol concentration of > 5%.
*. May exhibit star activity in this buffer.

Tampão CutSmart® da NEB

Simplifique a configuração da reação e a dupla digestão com o tampão CutSmart!

Mais de 215 enzimas de restrição são 100% ativas em um único tampão, o CutSmart Buffer, facilitando significativamente a configuração de suas reações de digestão dupla.

Como o CutSmart Buffer inclui BSA, também existem menos etapas de pipetagens e tubos para se preocupar.
Além disso, muitas enzimas modificadoras de DNA são 100% ativas no CutSmart Buffer, eliminando a necessidade de purificação subsequente.